Python Developer

I cannot add the integer number 1 to an existing set. In an interactive shell, this is what I am do… Read more Adding The Number 1 To A Set Has No Effect

Suppose we are given n sets and want to construct all minimal sets that have at least one element i… Read more Find Sets That Contain At Least One Element From Other Sets

I couldn't figure out how to perform line.startswith('substring') for a set of substrin… Read more Check If String Begins With One Of Several Substrings In Python

I'm trying to execute the following >> from numpy import * >> x = array([[3,2,3],[4… Read more Constructing A Python Set From A Numpy Matrix

I recently posted a question using a lambda function and in a reply someone had mentioned lambda is… Read more Lambda Versus List Comprehension Performance

I have two lists l and l_match. l_match is an empty list. l = ['gtttaattgagttgtcatatgttaataacg… Read more Preserving The Order In Difference Between Two Lists

Suppose I have the following set: things = {'foo', 'bar', 'baz'} I would l… Read more Check For Any Values In Set

I have confused with lists, tuples, sets and dictionaries someone give me clear cut idea. Give me t… Read more What Is The Difference Between Lists,tuples,sets And Dictionaries?

I got the following error AttributeError: 'NoneType' object has no attribute 'add'… Read more Attributeerror: 'nonetype' Object Has No Attribute 'add'

Like many other questions on here, I'm attempting to remove duplicates from a list. However, wh… Read more Why Do I Get An Unhashable Type 'list' Error When Converting A List To A Set And Back

I have a question regarding the .pop() method. In the documentation, it states that on sets: Remov… Read more Python: .pop() On Unordered Sets

I would like to get an element from a frozenset (without modifying it, of course, as frozensets are… Read more How To Get An Arbitrary Element From A Frozenset?

Sometimes I have a list and I want to do some set actions with it. What I do is to write things lik… Read more Create A Set From A List Using {}

I'm puzzled by this behaviour of memory allocation of sets: >>> set(range(1000)).__siz… Read more Why Does Union Consume More Memory If The Argument Is A Set?

I have a list that is generated from multiple lists. This combined list contains names that are gen… Read more Case Insensitive For Sets In Python

The title says it all: I am looking for a standard way to preserve Python [frozen]sets in a MySQL d… Read more Is There A Mysql Equivalent To Python's Set Type?

I have two files one has key and other has both key and value. I have to match the key of file one … Read more Dict And List Manipulation Python

I have below list: a=[{'list1': ['35,36,37,38,39,40,41,42,43,44,45,46,47,48,49,50,51,52… Read more Get Common Values Out Of A List In Python

I am porting some C++ code to Python and one of the data structures is a multiset, but I am not sur… Read more Is There A Python Equivalent For C++ "multiset"?

So I have a tuple of tuples a = ((1, 2), (7, 2), (5, 2), (3, 4), (8, 4)) I would like to remove al… Read more Making A Sequence Of Tuples Unique By A Specific Element